OligoTM 1.0

About the program:

calculates oligo melting temperature (Tm) and GC content. This tool is using small application called oligotm from Primer3 package.

Calculations of the melting temperature and salt correction are based on the formulas published in:

  1. Breslauer KJ, Frank R, Blöcker H and Marky LA. (1986) Predicting DNA duplex stability from the base sequence. Proc. Natl. Acad. Sci., 83, 4746-50.
  2. Rychlik W, Spencer WJ and Rhoads RE. (1990) Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res., 118, 6409-12.
  3. SantaLucia JR. (1998). A unified view of polymer, dumbbell and oligonucleotide DNA nearest-neighbor thermodynamics. Proc. Natl. Acad. Sci., 95, 1460-65.
  4. Schildkraut, C, and Lifson, S. (1965) Dependence of the melting temperature of DNA on salt concentration. Biopolymers, 3, 195-208.
  5. Owczarzy R, You Y, Moreira BG, Manthey JA, Huang L, Behlke MA and Walder JA. (2004) Effects of Sodium Ions on DNA Duplex Oligomers: Improved Predictions of Melting Temperatures. Biochemistry, 43, 3537-54.
  6. Owczarzy R, Moreira BG, You Y, Behlke MA and Walder JA. (2008) Predicting Stability of DNA Duplexes in Solutions Containing Magnesium and Monovalent Cations. Biochemistry, 47, 5336-53.

Here is a list of updates and bugfixes: update.txt

Here is a correct input file: sample.txt

For further information please contact: reidar.andreson [at] ut.ee.

There have been 31896 submissions to this web site since February 2008.

Please insert oligo sequence or upload file:

Allowed characters in sequence: A,C,G,T,N,a,c,g,t,n. Other characters are converted to N.

If You have more primers, please upload Your own input file (plain .txt file only!). All ID's and sequences must be separated by tabulator.

Primer1     TGCACAATTTGATGCCGGTTTAGTAT
Primer2     TTAAAATGCAGATGCTGAACTGGGAA

OligoTM parameters:
[Monovalent cation]: (mM) [Divalent cation]: (mM)
[Annealing oligo]: (nM) [dNTP]: (mM)

University of Tartu, Department of Bioinformatics 2026