GenomeTester Help

Overview of the program

GenomeTester tests quickly user-provided PCR primers against the Human genome. This is necessary to find and eliminate primers with excessive number of binding sites (to avoid failed PCR) and to find alternative PCR products (to avoid false signals in genotyping experiment). GenomeTester is optimized for the Human genome, however other completely sequenced genomes can also be used.

GenomeTester tests 1) whether PCR primers have excessive number of binding sites on template sequence and 2) how many PCR products would be amplified from the template DNA and where are they located.

Input data

User can insert primer ID and primer sequences into the textfields or include *.txt file containing multiple primer pairs. Allowed letters in primer sequences are: A,T,G,C and N.

If You have more than one primer pairs, please select Your own input file. All ID's and sequences must be separated by tabs:

    Primer1   TGCACAATTTGATGCCGGTTTAGTAT     TTGTTGGTGGCTGCGTGCATAAT
    Primer2   TTAAAATGCAGATGCTGAACTGGGAA     TTGCTGTTTGATGGTGAATTAGGGAA

GenomeTester parameters

E-mail sending

Enter your email to be informed when the job is finished. The link to results will be sent by e-mail. Alternatively you can bookmark the page and come back later to check results.

Output of the program

statistics.txt:

This file contains statistics for GenomeTester - SNP/SEQ ID's, left and right primer binding sites and predicted (+ alternative) product numbers in Human genome.

primers.txt:

This file contains description of all primer binding sites: all alternative and correct primer binding sites for each SNP/SEQ ID, primer type (A or B), binding strand on DNA (1 means sense, -1 antisense), chromosome where these primers are located and their chromosome locations of the 5' end of the primer.

products.txt:

This file contains description of all PCR products: SNP/SEQ ID's, ordinal number of same ID's, chromosome number where these primers are located and their positions, product size they produce and type of product: 1 means primer A - primer B (sense strand product), -1 means primer B - primer A (antisense strand product), 2 means primer A - primer A product and -2 means primer B - primer B product.

multiplex.txt:

This file contains primer and product sequences. Tabulated txt file can be used as an input file to MultiPLX program to create groups.

results.zip file:

This file contains all results files and they are packed with zip program.

For further information please contact: