GenomeTester 1.3

About the program:

GenomeTester 1.3 tests 1) whether PCR primers have excessive number of binding sites on template sequence and 2) how many PCR products would be amplified from the template DNA and where are they located. Having too many binding sites will typically result in failed PCR. Amplifying more than one product is undesireable because alternative PCR products could cause false positive signals in genotyping.
Index files are created with word size 16.

Stand-alone GenomeTester binaries (GenomeMasker package), example files and README are available here.
Here is a correct input file.

For further information please contact: reidar.andreson [at] ut.ee and please check the HELP page too.

GenomeTester is a part of services provided by ELIXIR - European research infrastructure for biological information. For other services provided by ELIXIR's Estonian Node visit https://elixir.ut.ee/services/.

How to cite GenomeTester: Andreson R., Reppo E., Kaplinski L., Remm M. GENOMEMASKER package for designing unique genomic PCR primers. BMC Bioinformatics 2006, 7:172. [PubMed] [Full Text]

There have been 247342 submissions to this web site since February 2005.

Please select the genome:
Please insert primer ID, LEFT and RIGHT primer sequence or upload file:
ID: LEFT: RIGHT:

If You have more than one primer pair, please upload Your own input file (plain .txt file only!). All ID's and sequences must be separated by tabs.

Primer1     TGCACAATTTGATGCCGGTTTAGTAT     TTGTTGGTGGCTGCGTGCATAAT
Primer2     TTAAAATGCAGATGCTGAACTGGGAA     TTGCTGTTTGATGGTGAATTAGGGAA
Use bisulphite-treated genomic DNA (currently HUMAN only): Maximum product size: Primer matches to show:
If you enter Your email address, You will get an email when GenomeTester job is finished (optional):

University of Tartu, Department of Bioinformatics 2026