Primer3 Input Help (release 0.4.0)

Cautions

Techniques for avoiding problems include a thorough understanding of possible vector contaminants and cloning artifacts coupled with database searches using blast, fasta, or other similarity searching program to screen for vector contaminants and possible repeats. Repbase (J. Jurka, A.F.A. Smit, C. Pethiyagoda, and others, 1995-1996) ftp://ftp.ncbi.nih.gov/repository/repbase) is an excellent source of repeat sequences and pointers to the literature. Primer3 now allows you to screen candidate oligos against a Mispriming Library (or a Mishyb Library in the case of internal oligos).

Sequence quality can be controlled by manual trace viewing and quality clipping or automatic quality clipping programs. Low- quality bases should be changed to N's or can be made part of Excluded Regions. The beginning of a sequencing read is often problematic because of primer peaks, and the end of the read often contains many low-quality or even meaningless called bases. Therefore when picking primers from single-pass sequence it is often best to use the Included Region parameter to ensure that Primer3 chooses primers in the high quality region of the read. In addition, Primer3 takes as input a Sequence Quality list for use with those base calling programs such as Phred that output this information.

Source Sequence

The sequence from which to select primers or hybridization oligos.

Sequence Id

An identifier that is reproduced in the output to enable you to identify the chosen primers.

Targets

If one or more Targets is specified then a legal primer pair must flank at least one of them. A Target might be a simple sequence repeat site (for example a CA repeat) or a single-base-pair polymorphism. The value should be a space-separated list of

start,length

pairs where start is the index of the first base of a Target, and length is its length.

Excluded Regions

Primer oligos may not overlap any region specified in this tag. The associated value must be a space-separated list of

start,length

pairs where start is the index of the first base of the excluded region, and length is its length. This tag is useful for tasks such as excluding regions of low sequence quality or for excluding regions containing repetitive elements such as ALUs or LINEs.

Product Size Range

A list of product size ranges, for example

150-250 100-300 301-400

Primer3 first tries to pick primers in the first range. If that is not possible, it goes to the next range and tries again. It continues in this way until it has either picked all necessary primers or until there are no more ranges. For technical reasons this option makes much lighter computational demands than the Product Size option.

Product Size

Minimum, Optimum, and Maximum lengths (in bases) of the PCR product. Primer3 will not generate primers with products shorter than Min or longer than Max, and with default arguments Primer3 will attempt to pick primers producing products close to the Optimum length.

Number To Return

The maximum number of primer pairs to return. Primer pairs returned are sorted by their "quality", in other words by the value of the objective function (where a lower number indicates a better primer pair). Caution: setting this parameter to a large value will increase running time.

Max 3' Stability

The maximum stability for the last five 3' bases of a left or right primer. Bigger numbers mean more stable 3' ends. The value is the maximum delta G (kcal/mol) for duplex disruption for the five 3' bases as calculated using the Nearest-Neighbor parameter values specified by the option of 'Table of thermodynamic parameters'. For example if the table of thermodynamic parameters suggested by SantaLucia 1998, DOI:10.1073/pnas.95.4.1460 is used the deltaG values for the most stable and for the most labile 5mer duplex are 6.86 kcal/mol (GCGCG) and 0.86 kcal/mol (TATAT) respectively. If the table of thermodynamic parameters suggested by Breslauer et al. 1986, 10.1073/pnas.83.11.3746 is used the deltaG values for the most stable and for the most labile 5mer are 13.4 kcal/mol (GCGCG) and 4.6 kcal/mol (TATAC) respectively.

Max Mispriming

The maximum allowed weighted similarity with any sequence in Mispriming Library. Default is 12.

Pair Max Mispriming

The maximum allowed sum of similarities of a primer pair (one similarity for each primer) with any single sequence in Mispriming Library. Default is 24. Library sequence weights are not used in computing the sum of similarities.

Primer Size

Minimum, Optimum, and Maximum lengths (in bases) of a primer oligo. Primer3 will not pick primers shorter than Min or longer than Max, and with default arguments will attempt to pick primers close with size close to Opt. Min cannot be smaller than 1. Max cannot be larger than 36. (This limit is governed by maximum oligo size for which melting-temperature calculations are valid.) Min cannot be greater than Max.

Primer T_m

Minimum, Optimum, and Maximum melting temperatures (Celsius) for a primer oligo. Primer3 will not pick oligos with temperatures smaller than Min or larger than Max, and with default conditions will try to pick primers with melting temperatures close to Opt.

By default Primer3 uses the oligo melting temperature formula and the table of thermodynamic parameters given in Breslauer et al. 1986, DOI:10.1073/pnas.83.11.3746 For more information see caption Table of thermodynamic parameters

Maximum T_m Difference

Maximum acceptable (unsigned) difference between the melting temperatures of the left and right primers.

Table of thermodynamic parameters

Option for the table of Nearest-Neighbor thermodynamic parameters and for the method of melting temperature calculation. Two different tables of thermodynamic parameters are available:

1. Breslauer et al. 1986, DOI:10.1073/pnas.83.11.3746 In that case the formula for melting temperature calculation suggested by Rychlik et al. 1990 is used (this is used until Primer3 version 1.0.1). This is the default value of Primer3 (for backward compatibility).
2. SantaLucia 1998, DOI:10.1073/pnas.95.4.1460 This is the recommended value.

For specifying the salt correction method for melting temperature calculation see Salt correction formula

Product T_m

The minimum, optimum, and maximum melting temperature of the amplicon. Primer3 will not pick a product with melting temperature less than min or greater than max. If Opt is supplied and the Penalty Weights for Product Size are non-0 Primer3 will attempt to pick an amplicon with melting temperature close to Opt.

The maximum allowed melting temperature of the amplicon. Primer3 calculates product T_m calculated using the formula from Bolton and McCarthy, PNAS 84:1390 (1962) as presented in Sambrook, Fritsch and Maniatis, Molecular Cloning, p 11.46 (1989, CSHL Press).

T_m = 81.5 + 16.6(log₁₀([Na+])) + .41*(%GC) - 600/length,

where [Na+] is the molar sodium concentration, (%GC) is the percent of Gs and Cs in the sequence, and length is the length of the sequence.

A similar formula is used by the prime primer selection program in GCG (http://www.gcg.com), which instead uses 675.0 / length in the last term (after F. Baldino, Jr, M.-F. Chesselet, and M.E. Lewis, Methods in Enzymology 168:766 (1989) eqn (1) on page 766 without the mismatch and formamide terms). The formulas here and in Baldino et al. assume Na+ rather than K+. According to J.G. Wetmur, Critical Reviews in BioChem. and Mol. Bio. 26:227 (1991) 50 mM K+ should be equivalent in these formulae to .2 M Na+. Primer3 uses the same salt concentration value for calculating both the primer melting temperature and the oligo melting temperature. If you are planning to use the PCR product for hybridization later this behavior will not give you the T_m under hybridization conditions.

Primer GC% Minimum, Optimum, and Maximum percentage of Gs and Cs in any primer.

Max Complementarity

The maximum allowable local alignment score when testing a single primer for (local) self-complementarity and the maximum allowable local alignment score when testing for complementarity between left and right primers. Local self-complementarity is taken to predict the tendency of primers to anneal to each other without necessarily causing self-priming in the PCR. The scoring system gives 1.00 for complementary bases, -0.25 for a match of any base (or N) with an N, -1.00 for a mismatch, and -2.00 for a gap. Only single-base-pair gaps are allowed. For example, the alignment

5' ATCGNA 3'
   || | |
3' TA-CGT 5'

is allowed (and yields a score of 1.75), but the alignment

5' ATCCGNA 3'
   ||  | |
3' TA--CGT 5'

is not considered. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable local alignment between two oligos.

Max 3' Complementarity

The maximum allowable 3'-anchored global alignment score when testing a single primer for self-complementarity, and the maximum allowable 3'-anchored global alignment score when testing for complementarity between left and right primers. The 3'-anchored global alignment score is taken to predict the likelihood of PCR-priming primer-dimers, for example

5' ATGCCCTAGCTTCCGGATG 3'
             ||| |||||
          3' AAGTCCTACATTTAGCCTAGT 5'

or

5` AGGCTATGGGCCTCGCGA 3'
               ||||||
            3' AGCGCTCCGGGTATCGGA 5'

The scoring system is as for the Max Complementarity argument. In the examples above the scores are 7.00 and 6.00 respectively. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable 3'-anchored global alignment between two oligos. In order to estimate 3'-anchored global alignments for candidate primers and primer pairs, Primer assumes that the sequence from which to choose primers is presented 5'->3'. It is nonsensical to provide a larger value for this parameter than for the Maximum (local) Complementarity parameter because the score of a local alignment will always be at least as great as the score of a global alignment.

Max Poly-X

The maximum allowable length of a mononucleotide repeat, for example AAAAAA.

Included Region

A sub-region of the given sequence in which to pick primers. For example, often the first dozen or so bases of a sequence are vector, and should be excluded from consideration. The value for this parameter has the form

start,length

where start is the index of the first base to consider, and length is the number of subsequent bases in the primer-picking region.

Start Codon Position

This parameter should be considered EXPERIMENTAL at this point. Please check the output carefully; some erroneous inputs might cause an error in Primer3. Index of the first base of a start codon. This parameter allows Primer3 to select primer pairs to create in-frame amplicons e.g. to create a template for a fusion protein. Primer3 will attempt to select an in-frame left primer, ideally starting at or to the left of the start codon, or to the right if necessary. Negative values of this parameter are legal if the actual start codon is to the left of available sequence. If this parameter is non-negative Primer3 signals an error if the codon at the position specified by this parameter is not an ATG. A value less than or equal to -10^6 indicates that Primer3 should ignore this parameter. Primer3 selects the position of the right primer by scanning right from the left primer for a stop codon. Ideally the right primer will end at or after the stop codon.

Mispriming Library

This selection indicates what mispriming library (if any) Primer3 should use to screen for interspersed repeats or for other sequence to avoid as a location for primers. The human and rodent libraries on the web page are adapted from Repbase (J. Jurka, A.F.A. Smit, C. Pethiyagoda, et al., 1995-1996) ftp://ftp.ncbi.nih.gov/repository/repbase). The human library is humrep.ref concatenated with simple.ref, translated to FASTA format. There are two rodent libraries. One is rodrep.ref translated to FASTA format, and the other is rodrep.ref concatenated with simple.ref, translated to FASTA format.

The Drosophila library is the concatenation of two libraries from the Berkeley Drosophila Genome Project:

1. A library of transposable elements The transposable elements of the Drosophila melanogaster euchromatin - a genomics perspective J.S. Kaminker, C.M. Bergman, B. Kronmiller, J. Carlson, R. Svirskas, S. Patel, E. Frise, D.A. Wheeler, S.E. Lewis, G.M. Rubin, M. Ashburner and S.E. Celniker Genome Biology (2002) 3(12):research0084.1-0084.20, http://www.fruitfly.org/p_disrupt/datasets/ASHBURNER/D_mel_transposon_sequence_set.fasta

2. A library of repetitive DNA sequences http://www.fruitfly.org/sequence/sequence_db/na_re.dros.

Both were downloaded 6/23/04.

The contents of the libraries can be viewed at the following links:

• HUMAN (contains microsatellites)
• RODENT_AND_SIMPLE (contains microsatellites)
• RODENT (does not contain microsatellites)
• DROSOPHILA

CG Clamp

Require the specified number of consecutive Gs and Cs at the 3' end of both the left and right primer. (This parameter has no effect on the hybridization oligo if one is requested.)

Concentration of monovalent cations

The millimolar concentration of salt (usually KCl) in the PCR. Primer3 uses this argument to calculate oligo melting temperatures.

Concentration of divalent cations

The millimolar concentration of divalent salt cations (usually MgCl²⁺ in the PCR). Primer3 converts concentration of divalent cations to concentration of monovalent cations using formula suggested in the paper Ahsen et al., 2001

                     [Monovalent cations] = [Monovalent cations] + 120*(√([divalent cations] - [dNTP])) 

According to the formula concentration of desoxynucleotide triphosphate [dNTP] must be smaller than concentration of divalent cations. The concentration of dNTPs is included to the formula beacause of some magnesium is bound by the dNTP. Attained concentration of monovalent cations is used to calculate oligo/primer melting temperature. See Concentration of dNTPs to specify the concentration of dNTPs.

Concentration of dNTPs

The millimolar concentration of deoxyribonucleotide triphosphate. This argument is considered only if Concentration of divalent cations is specified.

Salt correction formula

Option for specifying the salt correction formula for the melting temperature calculation.

There are three different options available:
1. Schildkraut and Lifson 1965, DOI:10.1002/bip.360030207 (this is used until the version 1.0.1 of Primer3). The default value of Primer3 version 1.1.0 (for backward compatibility)
2. SantaLucia 1998, DOI:10.1073/pnas.95.4.1460 This is the recommended value.
3. Owczarzy et al. 2004, DOI:10.1021/bi034621r

Annealing Oligo Concentration

The nanomolar concentration of annealing oligos in the PCR. Primer3 uses this argument to calculate oligo melting temperatures. The default (50nM) works well with the standard protocol used at the Whitehead/MIT Center for Genome Research--0.5 microliters of 20 micromolar concentration for each primer oligo in a 20 microliter reaction with 10 nanograms template, 0.025 units/microliter Taq polymerase in 0.1 mM each dNTP, 1.5mM MgCl2, 50mM KCl, 10mM Tris-HCL (pH 9.3) using 35 cycles with an annealing temperature of 56 degrees Celsius. This parameter corresponds to 'c' in Rychlik, Spencer and Rhoads' equation (ii) (Nucleic Acids Research, vol 18, num 21) where a suitable value (for a lower initial concentration of template) is "empirically determined". The value of this parameter is less than the actual concentration of oligos in the reaction because it is the concentration of annealing oligos, which in turn depends on the amount of template (including PCR product) in a given cycle. This concentration increases a great deal during a PCR; fortunately PCR seems quite robust for a variety of oligo melting temperatures.

Max Ns Accepted

Maximum number of unknown bases (N) allowable in any primer.

Liberal Base

This parameter provides a quick-and-dirty way to get Primer3 to accept IUB / IUPAC codes for ambiguous bases (i.e. by changing all unrecognized bases to N). If you wish to include an ambiguous base in an oligo, you must set Max Ns Accepted to a non-0 value. Perhaps '-' and '* ' should be squeezed out rather than changed to 'N', but currently they simply get converted to N's. The authors invite user comments.

First Base Index

The index of the first base in the input sequence. For input and output using 1-based indexing (such as that used in GenBank and to which many users are accustomed) set this parameter to 1. For input and output using 0-based indexing set this parameter to 0. (This parameter also affects the indexes in the contents of the files produced when the primer file flag is set.) In the WWW interface this parameter defaults to 1.

Inside Target Penalty

Non-default values valid only for sequences with 0 or 1 target regions. If the primer is part of a pair that spans a target and overlaps the target, then multiply this value times the number of nucleotide positions by which the primer overlaps the (unique) target to get the 'position penalty'. The effect of this parameter is to allow Primer3 to include overlap with the target as a term in the objective function.

Outside Target Penalty

Non-default values valid only for sequences with 0 or 1 target regions. If the primer is part of a pair that spans a target and does not overlap the target, then multiply this value times the number of nucleotide positions from the 3' end to the (unique) target to get the 'position penalty'. The effect of this parameter is to allow Primer3 to include nearness to the target as a term in the objective function.

Show Debuging Info

Include the input to primer3_core as part of the output.

Lowercase masking

If checked candidate primers having lowercase letter exactly at 3' end are rejected. This option allows to design primers overlapping lowercase-masked regions. This property relies on the assumption that masked features (e.g. repeats) can partly overlap primer, but they cannot overlap the 3'-end of the primer. In other words, the lowercase letters in other positions are accepted, assuming that the masked features do not influence the primer performance if they do not overlap the 3'-end of primer.

Sequence Quality

Sequence Quality

A list of space separated integers. There must be exactly one integer for each base in the Source Sequence if this argument is non-empty. High numbers indicate high confidence in the base call at that position and low numbers indicate low confidence in the base call at that position.

Min Sequence Quality

The minimum sequence quality (as specified by Sequence Quality) allowed within a primer.

Min 3' Sequence Quality

The minimum sequence quality (as specified by Sequence Quality) allowed within the 3' pentamer of a primer.

Sequence Quality Range Min

The minimum legal sequence quality (used for interpreting Min Sequence Quality and Min 3' Sequence Quality).

Sequence Quality Range Max

The maximum legal sequence quality (used for interpreting Min Sequence Quality and Min 3' Sequence Quality).

Penalty Weights

• Product Size
• Primer Size
• Primer T_m
• Product T_m
• Primer GC%
• Hyb Oligo Size
• Hyb Oligo T_m
• Hyb Oligo GC%

For the remaining parameters the optimum is understood and the actual value can only vary in one direction from the optimum:

• Primer Self Complementarity
• Primer 3' Self Complementarity
• Primer #N's
• Primer Mispriming Similarity
• Primer Sequence Quality
• Primer 3' Sequence Quality
• Primer 3' Stability
• Hyb Oligo Self Complementarity
• Hyb Oligo 3' Self Complementarity
• Hyb Oligo Mispriming Similarity
• Hyb Oligo Sequence Quality
• Hyb Oligo 3' Sequence Quality

Position Penalty Weight

Determines the overall weight of the position penalty in calculating the penalty for a primer.

Primer Weight

Determines the weight of the 2 primer penalties in calculating the primer pair penalty.

Hyb Oligo Weight

Determines the weight of the hyb oligo penalty in calculating the penalty of a primer pair plus hyb oligo.

• T_m difference
• Primer-Primer Complementarity
• Primer-Primer 3' Complementarity
• Primer Pair Mispriming Similarity

Hyb Oligos (Internal Oligos)

Copyright Notice and Disclaimer

Redistribution and use in source and binary forms, with or without modification, are permitted provided that the following conditions are met:

1. Redistributions must reproduce the above copyright notice, this list of conditions and the following disclaimer in the documentation and/or other materials provided with the distribution. Redistributions of source code must also reproduce this information in the source code itself.
2. If the program is modified, redistributions must include a notice (in the same places as above) indicating that the redistributed program is not identical to the version distributed by Whitehead Institute.
3. All advertising materials mentioning features or use of this software must display the following acknowledgment:

   This product includes software developed by the Whitehead Institute for Biomedical Research.

4. The name of the Whitehead Institute may not be used to endorse or promote products derived from this software without specific prior written permission.

Steve Rozen and Helen J. Skaletsky (2000) Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, NJ, pp 365-386
Source code available at http://fokker.wi.mit.edu/primer3/.

Acknowledgments

We gratefully acknowledge the support of Digital Equipment Corporation, which provided the Alphas which were used for much of the development of Primer3, and of Centerline Software, Inc., whose TestCenter memory-error, -leak, and test-coverage checker we use regularly to discover and correct otherwise latent errors in Primer3.